目录

Stranger

Build Status - GitHub PyPI Version DOI GitHub Release Date Coverage Status Code style: black Woke

Annotates output files from ExpansionHunter and TRGT with the pathologic implications of the repeat sizes.

Installation

Stranger uses the uv project manager. It is very quick and lightweight - see the uv installation instructions.

git clone github.com/clinical-genomics/stranger
cd stranger
uv pip install --editable .

Usage

uv run stranger --help
Usage: stranger [OPTIONS] VCF

  Annotate str variants with str status

Options:
  -f, --repeats-file PATH         Path to a file with repeat definitions. See
                                  README for explanation  [default: $HOME/
                                  stranger/stranger/resources/vari
                                  ant_catalog_grch37.json]
  -i, --family_id TEXT
  -t, --trgt                      File was produced with TRGT
  --version
  --loglevel [DEBUG|INFO|WARNING|ERROR|CRITICAL]
                                  Set the level of log output.  [default:
                                  INFO]
  --help                          Show this message and exit.

Repeat definitions

The repeats are called with Expansion Hunter as mentioned earlier. ExpansionHunter will annotate the number of times that a repeat has been seen in the bam files of each individual and what repeat id the variant has. Stranger will annotate the level of pathogenicity for the repeat number. The intervals that comes with the package are manually collected from the literature since there is no single source where this information can be collected.

You can find a demo repeat definitions json file that comes with Stranger here. It is based on the ExpansionHunter variant catalog, but extended with a few disease locus relevant keys: It is advisable to use an up to date file, perhaps based on a curated public repostitory such as STRchive or STRipy. The ones we use in our routine pipelines can be found at our Reference-files repository and include our literature curation.

Column/Key Content/Value
HGNC_ID HGNC identifier for the repeat or most associated gene.
HGNC_SYMBOL HGNC symbol for the repeat or most associated gene.
REPID ExpansionHunter repeat ID.
RU Basic repeat unit, as seen in ExpansionHunter. Unused.
DisplayRU Repeat unit, as clinicians are used to see it.
Normal_Max (#copies) Longest repeat expected for normal individual; higher are marked pre- or full-mutation
Pathologic_Min (#copies) Shortest repeat expected for pathology. This and higher is annotated as full-mutation.
Disease Associated disease.
InheritanceMode Mode of inheritance “AR”, “AD”, “XR” etc
Source Reference literature resource type, eg GeneReviews or PubMed
SourceId PMID or GeneReviews book ID for references
TRID Trgt repeat ID if not same as REPID
PathologicStruc Array of index for pathogenic motif

Other fields accepted by ExpansionHunter are also encouraged.

For convenience, here is a formatted table with some of the current contents.
HGNCId LocusId DisplayRU InheritanceMode normal_max pathologic_min Disease SourceDisplay SourceId
3776 AFF2 CCG XR 39 200 Fraxe GeneReviews Internet 2019-11-07 NBK535148
644 AR CAG XR 34 38 SBMA GeneReviews Internet 2019-11-07 NBK535148
18060 ARX_EIEE GCN XR 16 17 EIEE GeneReviews Internet 2019-11-07 NBK535148
18060 ARX_PRTS GCN XR 12 20 PRTS GeneReviews Internet 2019-11-07 NBK535148
3033 ATN1 CAG AD 35 48 DRPLA GeneReviews Internet 2019-11-07 NBK535148
10549 ATXN10 ATTCT AD 32 800 SCA10 GeneReviews Internet 2019-11-07 NBK535148
10548 ATXN1 CAG AD 35 45 SCA1 GeneReviews Internet SCA1 2017-06-22 NBK1184
10555 ATXN2 CAG AD 31 37 SCA2 GeneReviews Internet SCA2 2019-02-14 NBK1275
7106 ATXN3 CAG AD 44 60 MJD GeneReviews Internet 2019-11-07 NBK535148
10560 ATXN7 CAG AD 19 36 SCA7 GeneReviews Internet 2019-11-07 NBK535148
10561 ATXN8OS CTG AD 50 80 SCA8 GeneReviews Internet 2019-11-07 NBK535148
28337 C9ORF72 GGCCCC AD 25 40 FTDALS1 GeneReviews Internet 2019-11-07 NBK535148
1388 CACNA1A CAG AD 18 20 SCA6 GeneReviews Internet 2019-11-07 NBK535148
1541 CBL CCG AD 79 100 FRAX11B Jones et al Nature 1995 7603564
1541 BEAN1 TGGAA AD 10 40 SCA31 Sato et al AJHG 2009 7603564
13164 CNBP CCTG AD 30 75 DM2 GeneReviews Internet 2020-03-19 NBK1466
2482 CSTB CCCCGCCCCGCG AR 3 30 EPM1 GeneReviews Internet 2019-11-07 NBK535148
2482 DAB1 ATTTC AD 16 31 SCA37 GeneReviews Internet 2019-05-30 NBK541729
29284 DIP2B CGG AD 24 270 FRA12A GeneReviews Internet 2019-11-07 NBK535148
2933 DMPK CTG AD 34 50 DM1 GeneReviews Internet 2019-10-03 NBK1165
18683 EIF4A3 TCGGCAGCGGCGCAGCGAGG AR 9 10 RCPS GeneReviews Internet 2019-11-07 NBK535148
3775 FMR1 CGG XR 55 200 FragileX GeneReviews Internet 2019-11-07 NBK535148
1092 FOXL2 GCN AD 14 15 BPES GeneReviews Internet 2019-11-07 NBK535148
3951 FXN GAA AR 35 51 FRDA GeneReviews Internet 2019-11-07 NBK535148
4331 GLS GCA AR 20 90 GDPAG van Kuilenburg et al (2019) NEJM 380:1433-1441 30970188
5102 HOXA13_I GCN AD 14 22 HFGS GeneReviews Internet 2019-08-08 NBK1423
5102 HOXA13_II GCN AD 12 18 HFGS GeneReviews Internet 2019-08-08 NBK1423
5102 HOXA13_III GCN AD 18 24 HFGS GeneReviews Internet 2019-08-08 NBK1423
5136 HOXD13 GCN AD 15 22 SDTY5 GeneReviews Internet 2019-11-07 NBK535148
4851 HTT CAG AD 36 40 Huntington GeneReviews Internet 2020-06-11 NBK1305
14203 JPH3 CTG AD 28 40 HDL2 GeneReviews Internet 2019-06-27 NBK1529
31708 LRP12 CGN AD 45 90 OPDM1 GeneReviews Internet 2019-11-07 NBK535148
1226 GIPC1 GGC AD 32 73 OPDM2 Deng et al (2020) AJHG 106(6):793-804 32413282
17043 NIPA1 GCN AD 8 10000 ALS - susceptibility to Tazelaar et al (2019) Neurobiol Aging 74:234.e9-234.e15 30342764
15911 NOP56 GGCCTG AD 14 650 SCA36 GeneReviews Internet 2014-08-07 NBK231880
53924 NOTCH2NLC CGG AD 38 66 NIID GeneReviews Internet 2019-11-07 NBK535148
8565 PABPN1 GCN AD 10 12 OPMD GeneReviews Internet 2014-02-20 NBK1126
9143 PHOX2B GCN AD 20 25 CCHS GeneReviews Internet 2014-01-30 NBK1427
9305 PPP2R2B CAG AD 32 51 SCA12 GeneReviews Internet 2019-11-07 NBK535148
16854 RAPGEF2 TTTCA AD 1 10 FAME7 Ishiura et al (2018) Nature Genetics 50;581-90 29507423
9969 RFC1 AARRG AR 11 12 CANVAS Cortese et al 2019 Nat Gen PMID: 30926972 30926972
31750 SAMD12 TTTCA AD 1 10 FAME1 Ishiura et al (2018) Nature Genetics 50;581-90 29507423
10472 RUNX2 GCN AD 17 20 CCD GeneReviews Internet 2019-11-07 NBK535148
11199 SOX3 GCN XR 15 22 MRGH GeneReviews Internet 2019-11-07 NBK535148
11588 TBP CAN AD 40 49 SCA17 GeneReviews Internet 2019-09-12 NBK1438
11592 TBX1 GCN AD 15 25 TOF GeneReviews Internet 2019-11-07 NBK535148
11634 TCF4 CTG AD 39 100 FECD3 GeneReviews Internet 2019-11-07 NBK535148
11969 TNRC6A TTTCA AD 1 10 FAME6 Ishiura et al (2018) Nature Genetics 50;581-90 29507423
15516 XYLT1 GGC AR 20 70 DBQD2 LaCroix et al (2018) AJHG 104(1):35-44 30554721
12873 ZIC2 GCN AD 15 25 HPE5 GeneReviews Internet 2019-11-07 NBK535148
12874 ZIC3 GCN XR 10 12 VACTERLX GeneReviews Internet 2019-11-07 NBK535148
9179 POLG CTG - 15 10000 - Research only. Contact CMMS, KUH, regarding findings. CMMS

Stranger can also read a legacy .tsv format file, structured like a Scout gene panel, with STR specific columns. The column names and keys correspond, but if in any kind of doubt, please read the code or use the json version.

As a default the file that follows the distribution is used but the users can create their own file. Header line(s) should be preceded with a #.

It is also possible to use an ExpansionHunter variant catalog json file with corresponding keys added. E.g.

[
    {
        "VariantType": "Repeat",
        "LocusId": "ATXN2",
        "LocusStructure": "(GCT)*",
        "ReferenceRegion": "chr12:112036753-112036822",
        "Disease": "SCA2",
        "NormalMax": 31,
        "PathologicMin": 39
    },
    {
        "VariantType": "Repeat",
        "LocusId": "PABPN1",
        "LocusStructure": "(GCG)*",
        "ReferenceRegion": "chr14:23790681-23790699",
        "Disease": "OPMD",
        "NormalMax": 6,
        "PathologicMin": 9
    }
]

Such files are also provided with the distribution. PRs with updates are much appreciated.

Output

Output is by annotated VCF, with keys STR_STATUS, NormalMax and PathologicMin.

##INFO=<ID=STR_STATUS,Number=A,Type=String,Description="Repeat expansion status. Alternatives in [normal, pre_mutation, full_mutation]">
4       3076603 .       C       <STR17>,<STR18> .       PASS    END=3076660;REF=19;RL=57;RU=CAG;VARID=HTT;REPID=HTT;STR_STATUS=normal,normal

TRGT mode

The flag --trgt will instruct Stranger to accept TRGT style VCFs. In particular, motif copy numbers are parsed from the GT.MC field and motifs listed in the PathologicStruc entry of the reference catalog:

    {
        "VariantType": "Repeat",
        "LocusId": "RAPGEF2",
        "HGNCId": 16854,
        "InheritanceMode": "AD",
        "DisplayRU": "TTTCA",
        "SourceDisplay": "Ishiura et al (2018) Nature Genetics 50 581-90",
        "Source": "PubMed",
        "SourceId": "29507423",
        "LocusStructure": "(TTTTA)*(TTTCA)*(TTTTA)*",
        "ReferenceRegion": [
            "4:160263679-160263703",
            "4:160263704-160263708",
            "4:160263709-160263768"
        ],
        "VariantType": [
            "Repeat",
            "Repeat",
            "Repeat"
        ],
        "VariantId": [
            "RAPGEF2_TTTTA_5P",
            "RAPGEF2",
            "RAPGEF2_TTTTA_3P"
        ],
        "PathologicRegion": "4:160263704-160263708",
        "PathologicStruc": [1],
        "Disease": "FAME7",
        "NormalMax": 1,
        "PathologicMin": 10
    },

and

...
##FORMAT=<ID=MC,Number=.,Type=String,Description="Motif counts per allele">
...
4    160263680    .    TTTATTTTATTTTATTTTATTTTATATTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATTTTATT    .    0    .    TRID=FAME7_RAPGEF2;END=160263770;MOTIFS=TTTTA,TTTCA;STRUC=(TTTTA)n(TTTCA)n(TTTTA)n;STR_STATUS=full_mutation;STR_NORMAL_MAX=1;STR_PATHOLOGIC_MIN=10;RankScore=internal_id_3:30;HGNCId=16854;InheritanceMode=AD;DisplayRU=TTTCA;SourceDisplay=Ishiura et al (2018) Nature Genetics 50 581-90;Source=PubMed;SourceId=29507423;Disease=FAME7    GT:AL:ALLR:SD:MC:MS:AP:AM    0/0:91,91:85-98,91-91:21,20:18_0,18_0:0(0-89)_1(89-89)_0(89-89),0(0-89)_1(89-89)_0(89-89):0.956044,0.956044:.,.    0/0:91,91:85-98,91-91:21,20:18_0,18_0:0(0-89)_1(89-89)_0(89-89),0(0-89)_1(89-89)_0(89-89):0.956044,0.956044:.,.    0/0:91,91:85-98,91-91:21,20:18_0,18_0:0(0-89)_1(89-89)_0(89-89),0(0-89)_1(89-89)_0(89-89):0.956044,0.956044:.,.
...
关于

用于短串联重复序列或致病重复扩增分析的软件,适用于遗传病研究。

523.0 KB
邀请码