Starcode: Sequence clustering based on all-pairs search
Contents:
1. What is starcode?
2. Source file list.
3. Compilation and installation.
4. Running starcode.
5. Running starcode-umi.
6. File formats.
7. License.
8. Citation.
I. What is starcode?
Starcode is a DNA sequence clustering software. Starcode clustering is
based on all pairs search within a specified
Levenshtein distance
(allowing insertions and deletions),
followed by a clustering algorithm: Message Passing, Spheres or Connected
Components. Typically, a file containing a set of DNA sequences is passed
as input, jointly with the desired clustering distance and algorihtm.
Starcode returns the canonical sequence of the cluster, the cluster size,
the set of different sequences that compose the cluster and the input line
numbers of the cluster components.
Starcode has many applications in the field of biology, such as DNA/RNA
motif recovery, barcode/UMI clustering, sequencing error recovery, etc.
II. Source file list
starcode-umi Starcode script to cluster UMI-tagged sequences.
main-starcode.c Starcode main file (parameter parsing).
starcode.c Main starcode algorithm.
trie.c Trie search and construction functions.
view.c Graphical representation of starcode output.
Makefile Make instruction file.
III. Compilation and installation
To install starcode, clone this git repository (or manually download the
latest release starcode v1.3):
By default, Starcode uses clustering parameters that are meaningful on many problems. Yet, the
output may not look exactly like you expect. This may be for the following reasons:
The clustering method is Message Passing. This means that clusters are built bottom-up by merging
small clusters into bigger ones. The process is recursive, so sequences in a cluster may not be
neighbors, i.e., they may not be within the specified Levenshtein distance. If this must be the
case, use sphere clustering instead (see option -s or –spheres below).
The clustering ratio is 5. This means that a cluster can absorb a smaller one only if it is at
least five times bigger. A practical implication is that clusters of similar size are not merged.
You can choose another threshold for merging clusters (see option -r or –cluster-ratio below).
Search options:
-d or –distancedistance
Defines the maximum Levenshtein distance for clustering.
When not set it is automatically computed as:
min(8, 2 + [median seq length]/30)
Clustering algorithm:
-r or –cluster-ratioratio
(Message passing only) Specifies the minimum sequence count ratio to cluster two matching
sequences, i.e. two matching sequences A and B will be clustered together only if
count(A) > ratio * count(B).
Sparse datasets may need to set -r to small values (minimum is 1.0) to trigger clustering.
Default is 5.0.
-s or –spheres
Use sphere clustering algorithm instead of message passing (MP). Spheres is more greedy than MP:
sorted by size, centroids absorb all their matches.
-c or –connected-comp
Clusters are defined by the connected components.
Output format:
–non-redundant
Removes redundant sequences from the output. Only the canonical sequence of each cluster is
returned.
–print-clusters
Adds a third column to the starcode output, containing the sequences that compose each cluster.
By default, the output contains only the centroid and the counts.
–seq-id
Shows the input sequence order (1-based) of the cluster components.
Input files:
Single-file mode:
-i or –inputfile
Specifies input file.
Paired-end fastq files:
-1file1-2file2
Specifies two paired-end FASTQ files for paired-end clustering mode.
Standard input is used when neither -i nor -1/-2 are set.
Output files:
-o or –outputfile
Specifies output file. When not set, standard output is used instead.
–output1file1–output2file2
(Paired-end mode with --non-redundant option only). Specifies the output file names of the
processed paired-end files.
Standard output is used when -o is not set.
When –output1/2 is not specified in paired-end –non-redundant mode, the output file
names are the input file names with a “-starcode” suffix.
Other options:
-t or –threadsthreads
Defines the maximum number of parallel threads.
Default is 1.
-q or –quiet
Non verbose. By default, starcode prints verbose information to
the standard error channel.
-v or –version
Prints version information.
-h or –help
Prints usage information.
V. Running starcode-umi
Starcode-umi is a python script that uses starcode to cluster UMI-tagged sequences.
UMI-tagged sequences are assumed to contain a unique molecular identifier at the beginning
of the read followed by some other (longer) sequence. Starcode-umi performs a double round
of clustering and merging to find the best possible clusters of UMI and sequence pairs.
Usage:
starcode-umi [options] –umi-len N input_file1 [input_file2]
Required arguments:
–umi-lennumber
Defines the length of the UMI tags. Adding some extra nucleotides may improve the clustering
performance.
–starcode-pathpath
Path to `starcode` binary file. Default is `./starcode`.
Clustering options:
–umi-ddistance
Match distance (Levenshtein) for the UMI region.
–seq-ddistance
Match distance (Levenshtein) for the sequence region.
–umi-clusterclustering algorithm
Clustering algorithm to be used in the UMI region. ('mp' for message passing, 's' for spheres,
'cc' for connected components). Default is message passing.
–seq-clusterclustering algorithm
Clustering algorithm to be used in the seq region. ('mp' for message passing, 's' for spheres,
'cc' for connected components). Default is message passing.
–umi-cluster-ratioclustering algorithm
(Only for message passing in UMI). Minimum clustering ratio (same as -r option in starcode).
–seq-cluster-ratioclustering algorithm
(Only for message passing in seq). Minimum clustering ratio (same as -r option in starcode).
–seq-trimtrim
Use only *trim* nucleotides of the sequence for clustering. Starcode becomes memory inefficient
with very long sequences, this parameter defines the maximum length of the sequence that will
be used for clustering. Set it to 0 to use the full sequence. Default is 50.
Output options:
–seq-id
Shows the input sequence order (1-based) of the cluster components.
Other options:
–umi-threadsthreads
Defines the maximum number of parallel threads to be used in the UMI process.
Default is 1.
–seq-threadsthreads
Defines the maximum number of parallel threads to be used in the sequence process.
Default is 1.
VI. File formats
VI.I. Supported input file formats:
VI.I.I. Plain text:
Consists of a file containing one sequence per line. Only the standard
DNA-base characters are supported (‘A’, ‘C’, ‘G’, ‘T’). The sequences
may not contain empty spaces at the beginning or the end of the string,
as these will be counted as alignment characters. The file may not
contain empty lines as these will be considered as zero-length sequences.
The sequences do not need to be sorted and may be repeated.
If the count of the sequences is known, it may be specified in the input
file using the following format:
[SEQUENCE]\t[COUNT]\n
Where ‘\t’ denotes the TAB character and ‘\n’ the NEWLINE character.
The sequences do not need to be sorted and may be repeated as well. If
a repeated sequence is found, their counts will be addded together. As
before, the sequences may not contain any additional characters and the
file may not contain empty lines.
Starcode supports FASTA and FASTQ files as well. Note, however, that
starcode does not use the quality factors and the only relevant
information is the sequence itself. The FASTA/FASTQ labels will not
be used to identify the sequences in the output file. The sequences do
not need to be sorted and may be repeated.
Example FASTA:
> FASTA sequence 1 label
ATGCATCGATCACTCATCAGCTACAG
> FASTA sequence 2 label
TATCGACTATCTACGACTACATCA
> FASTA sequence 3 label
ATCATCACTCTAGCAGCGTACTCGCA
> FASTA sequence 4 label
ATGCATCGATTACTCATCAGCTACAG
Where ‘\t’ denotes the TAB character and ‘\n’ the NEWLINE character.
‘CANONICAL SEQUENCE’ is the sequence of the cluster that has more
counts, ‘CLUSTER SIZE’ is the aggregated count of all the sequences
that form the cluster, and ‘CLUSTER SEQUENCES’ is a list of all the
cluster sequences separated by commas and in arbitrary order. The
lines are printed sorted by ‘CLUSTER SIZE’ in descending order.
For instance, an execution with the following input and clustering
distance of 3 (-d3):
In non-redundant output mode, starcode only prints the canonical
sequence of each cluster, one per line. Following the example from
the previous section, the output with distance 3 (-d3) would be:
Starcode: Sequence clustering based on all-pairs search
Contents:
I. What is starcode?
Starcode is a DNA sequence clustering software. Starcode clustering is based on all pairs search within a specified Levenshtein distance (allowing insertions and deletions), followed by a clustering algorithm: Message Passing, Spheres or Connected Components. Typically, a file containing a set of DNA sequences is passed as input, jointly with the desired clustering distance and algorihtm. Starcode returns the canonical sequence of the cluster, the cluster size, the set of different sequences that compose the cluster and the input line numbers of the cluster components.
Starcode has many applications in the field of biology, such as DNA/RNA motif recovery, barcode/UMI clustering, sequencing error recovery, etc.
II. Source file list
III. Compilation and installation
To install starcode, clone this git repository (or manually download the latest release starcode v1.3):
the files should be downloaded in a folder named ‘starcode’. Use make to compile (Mac users require ‘xcode’, available at the Mac Appstore):
a binary file ‘starcode’ will be created. You can optionally make a symbolic link to run starcode from any directory:
IV. Running starcode
Starcode runs on Linux and Mac. It has not been tested on Windows.
Usage:
Starcode defaults (please read this):
By default, Starcode uses clustering parameters that are meaningful on many problems. Yet, the output may not look exactly like you expect. This may be for the following reasons:
Search options:
-d or –distance distance
Clustering algorithm:
-r or –cluster-ratio ratio
-s or –spheres
-c or –connected-comp
Output format:
–non-redundant
–print-clusters
–seq-id
Input files:
Single-file mode:
-i or –input file
Specifies input file.
Paired-end fastq files:
-1 file1 -2 file2
Specifies two paired-end FASTQ files for paired-end clustering mode.
Standard input is used when neither -i nor -1/-2 are set.
Output files:
-o or –output file
–output1 file1 –output2 file2
Standard output is used when -o is not set.
When –output1/2 is not specified in paired-end –non-redundant mode, the output file names are the input file names with a “-starcode” suffix.
Other options:
-t or –threads threads
-q or –quiet
-v or –version
-h or –help
V. Running starcode-umi
Starcode-umi is a python script that uses
starcodeto cluster UMI-tagged sequences. UMI-tagged sequences are assumed to contain a unique molecular identifier at the beginning of the read followed by some other (longer) sequence. Starcode-umi performs a double round of clustering and merging to find the best possible clusters of UMI and sequence pairs.Usage:
Required arguments:
–umi-len number
–starcode-path path
Clustering options:
–umi-d distance
–seq-d distance
–umi-cluster clustering algorithm
–seq-cluster clustering algorithm
–umi-cluster-ratio clustering algorithm
–seq-cluster-ratio clustering algorithm
–seq-trim trim
Output options:
–seq-id
Other options:
–umi-threads threads
–seq-threads threads
VI. File formats
VI.I. Supported input file formats:
VI.I.I. Plain text:
Consists of a file containing one sequence per line. Only the standard DNA-base characters are supported (‘A’, ‘C’, ‘G’, ‘T’). The sequences may not contain empty spaces at the beginning or the end of the string, as these will be counted as alignment characters. The file may not contain empty lines as these will be considered as zero-length sequences. The sequences do not need to be sorted and may be repeated.
Example:
VI.I.II. Plain text with sequence count:
If the count of the sequences is known, it may be specified in the input file using the following format:
Where ‘\t’ denotes the TAB character and ‘\n’ the NEWLINE character. The sequences do not need to be sorted and may be repeated as well. If a repeated sequence is found, their counts will be addded together. As before, the sequences may not contain any additional characters and the file may not contain empty lines.
Example:
VI.I.III. FASTA/FASTQ
Starcode supports FASTA and FASTQ files as well. Note, however, that starcode does not use the quality factors and the only relevant information is the sequence itself. The FASTA/FASTQ labels will not be used to identify the sequences in the output file. The sequences do not need to be sorted and may be repeated.
Example FASTA:
Example FASTQ:
VI.II. Output formats:
VI.II.I Standard output format:
Starcode prints a line for each detected cluster with the following format:
Where ‘\t’ denotes the TAB character and ‘\n’ the NEWLINE character. ‘CANONICAL SEQUENCE’ is the sequence of the cluster that has more counts, ‘CLUSTER SIZE’ is the aggregated count of all the sequences that form the cluster, and ‘CLUSTER SEQUENCES’ is a list of all the cluster sequences separated by commas and in arbitrary order. The lines are printed sorted by ‘CLUSTER SIZE’ in descending order.
For instance, an execution with the following input and clustering distance of 3 (-d3):
would produce the following output:
The same example executed with a more restrictive distance -d2 would produce the following output:
VI.II.II Non-redundant output format:
In non-redundant output mode, starcode only prints the canonical sequence of each cluster, one per line. Following the example from the previous section, the output with distance 3 (-d3) would be:
whereas for -d2:
VII. License
Starcode is licensed under the GNU General Public License, version 3 (GPLv3), for more information read the LICENSE file or refer to:
http://www.gnu.org/licenses/
VIII. Citation
If you use our software, please cite:
Zorita E, Cusco P, Filion GJ. 2015. Starcode: sequence clustering based on all-pairs search. Bioinformatics 31 (12): 1913-1919.