目录

SeqVerify

SeqVerify is a Python-based command line tool for analysis of whole genome sequencing data for gene-editing verification. It performs insertion site detection, copy number variation (CNV) analysis through CNVPytor, bacterial contamination detection through KRAKEN2 and BRACKEN, and variant calling and filtering aided by SnpEff and SnpSift.

Install

Dependencies (& Dependencies of Dependencies)

  • BCFtools
  • BLAST
  • BRACKEN
  • BWA >=0.7
  • CNVPytor >=1.3
  • HTSLIB
  • IDNA
  • IGV >= 2.13.2
  • IGVReports
  • Kraken2 >= 2.0
  • Matplotlib(-base) >= 2.2
  • Numpy
  • Python >=3.10
  • SAMtools >=1.14
  • SciPy
  • SNPEff >= 5.1
  • SNPSift >= 4.3.1t

Install through bioconda

conda install -c bioconda seqverify

Usage

An example SeqVerify call can be found below:

seqverify --output output_name --reads_1 sample_1.fastq --reads_2 sample_2.fastq --genome genome.fa --untargeted transgenes.fa --targeted commands.txt --database db8gb

Anatomy of a SeqVerify call

SeqVerify has the following standard arguments:

  • --output (Type: String) Used as the identifying name for all the files and folders to do with the particular call. E.g. --output Sample1 will cause the output folder to be named “Sample1_seqverify”.
  • --reads_1 and --reads_2 (Type: String/Path) The paired-read FASTA/FASTQ, or gzipped FASTA/FASTQ source files for the reads. Also accepts paths to the files if they’re not in the working folder.
  • --genome (Type: String/Path) Name or path of FASTA file to be used as reference genome for the reads (e.g. CHM13). If not included, will default to CHM13v2.0, downloaded through --download_defaults.
  • --untargeted (Type: String/Path) Names or paths of FASTA files containing the sequences of the markers to detect (transgenes, unwanted plasmids, etc.). Accepts more than one if necessary, space-separated. Can also be left blank; not mutually exclusive with --targeted.
  • --targeted (Type: String/Path) Name or path to a valid command file for insertion of markers where the insertion site is known. Further details on the construction of a valid command files are given below. Only accepts one command file (but a command file can have multiple commands, so this will not restrict analysis). Can be left blank; not mutually exclusive with --untargeted.
  • --gtf (Type: String/Path) Name or path to valid GTF/GFF3 file for the genome used, to be updated with the exact edits specified in --targeted. If not included, will default to --download_defaults‘s GFF3 file for CHM13v2.0.

SeqVerify has the following optional arguments:

Performance
  • --threads (Type: Integer) Determines how many CPU threads are used in the multithreaded portion of the pipeline. Set to 1 by default.
  • --max_mem (Type: String) Determines what the maximum amount of memory to be used in the indexing of the reference genome should be. Expects an integer followed by “M” or “G” (case-sensitive) for “Megabytes” or “Gigabytes” respectively. Set by default to “16G”, 16 Gigabytes.
  • --start (Type: String) Determines where the pipeline starts. Can be set to:
    • “all” (the default option, runs the entire pipeline),
    • “beginning” (preprocessing),
    • “align” (skips the creation of the augmented genome and the output folders to start at the alignment process),
    • “markers” (skips to the creation of the insertion site readout),
    • “cnv” (skips to the CNV analysis),
    • “plots” (skips to the generation of the CNV plots),
    • “kraken” (skips to the microbial contamination analysis). Note that the --kraken argument must also be enabled to run this analysis.
    • “variant” (skips to SNV analysis). Note that the --variant_calling argument must also be enabled to run variant calling.

This option may be useful for core optimization on clusters: e.g. “beginning” is a single-core operation, “align” is a multi-core operation, so on a job scheduler a user could set a job dependent on the other and only use multiple cores when rquired. It may also be used to avoid having to restart the pipeline from scratch should the hardware or the software fail for any reason, or to perform further analysis on data that SeqVerify has already processed (e.g. add KRAKEN2 analysis when it wasn’t initially requested).

KRAKEN2
  • --kraken Enables KRAKEN2 analysis. If using a custom database, requires the --database option.
  • --database (Type: String/Path) Path to valid KRAKEN2 database, or, if the KRAKEN2 environmental variables are set, the name of the database. Only needed if --kraken set; if not set when --kraken is used, will default to the 8GB PlusPFP database downloaded by --download_defaults.
    Insertion Site Detection
  • --granularity (Type: Integer) Determines how large (in bp) insertion site bins are, i.e. how far apart two insertions can be in order to count as the same insertion site. Set by default to 500, a value of 1 means all insertions on different coordinates will be counted as different insertion sites and show up separately on the readout.
  • --min_matches (Type: Integer) Determines the minimum number of matches/insertions required for an insertion site to appear on the readout. Set by default to 1, i.e. shows any insertion, some of which may be false positives due to repetitive DNA or similar variables.
  • --mitochondrial (Type: Flag) If set, enables insertion site detection on chrM in the genome given for detection of mitochondrial DNA in the rest of the genome.
    CNVPytor
  • --bin_size (Type: Integer) Determines how many bp are binned together for the purposes of copy number variation detection. Default is 100000 (resulting in 100kbp bins), the minimum value is 1, but anything below the original read length (150 in the test data) will yield meaningless data.
  • --manual_plots Turns off IGVReports reports for the coverage plots of the transgenes provided, uses an internal matplotlib-based script instead. Not recommended unless there are issues with installing IGVReports or adjacent dependencies.
    Variant Calling
  • --variant_calling Turns on the variant calling portion of the pipeline, and takes two space-separated arguments: the name/path of a genome compatible with the VCF annotation DB used (e.g. hg38 for ClinVar), and the name/path to a valid annotation DB (e.g. ClinVar)
  • --variant_intensity (Type: String) Includes all variants at or above a certain severity level in the final variant readout. Can be set to (lowest) “MODIFIER”, “LOW”, “MODERATE”, or “HIGH” (highest). Set to “MODERATE” by default.
    Other
  • --keep_temp If enabled, keeps the temporary files created during the pipeline’s execution. It is off by default. Not recommended – temp files can reach upwards of 50-100GB (or much higher) depending on the read coverage.
  • --download_defaults If enabled, downloads the default genomes and databases to the working directory: T2T-CHM13v2.0, intended to be used in --genome, GRCh38/hg38 for variant calling, and the 8GB PlusPFP KRAKEN2 database (placed in a new folder named seqverify_database). Kills the program after downloading these, so anything in the command after seqverify --download_defaults is ignored.

Output

SeqVerify will output two folders, output_seqverify and output_seqverify_temp where “output” is the variable set in the --output argument.

output_seqverify_temp contains files that can be deleted after the pipeline is run, that are generated and used by the pipeline (SAM headers, .BED files, etc.).

soutput_seqverify contains the following files:

seqverify_output_markers.bam and seqverify_output_markers.bam.bai A BAM file containing the reads given in --reads_1 and --reads_2 realigned to the reference genome augmented with the marker genomes and its corresponding index.

seqverify_readout.txt The human-readable readout resulting from the insertion site detection portion of the pipeline. The outermost indentation represents the marker, the second indentation is the human chromosome it aligns to, and the third layer denotes the in-chromosome coordinate of the insertion site, and how many times the marker was aligned to it (with the minimum value being specified in --min_matches).

output.pytor The binaries output by CNVPytor. Can be used to generate further plots of specific regions if needed (refer to CNVPytor docs)

output.global.0000.png The Manhattan plot of copy number across the sample as output from output.pytor.

fig_marker.png A copy number histogram of the transgene in the genome. Default bin size is 30bp, and one histogram is output for every sequence specified in --markers.

If KRAKEN2 analysis is being performed, the pipeline will also output the following files in seqverify_output:

classified_seqs_output.kreport A human-readable report of the microbial sequences detected by KRAKEN2 in text format. Typically species with just a few reads (<10) can be ignored, but the presence of more than this could indicate contamination.

classified_output.kraken The KRAKEN2 binary output files used to generate the report.

classified_seqs_output_1.fq and classified_seqs_output_2.fq, FASTQ files containing the sequences that were classified in the KRAKEN2 database.

If SNV Analysis is being performed, the pipeline will output the following files:

seqverify_output.ann.vcf is the annotated VCF output of all variants present in the sample reads provided.

seqverify_output_variants.tsv is the filtered readout prepared by SeqVerify containing information about all variants above a set severity level, along with any loss of function or homozgosity data.

Example input and output

Example of WGS data with copy number abnormalities at the beginning of chromosome 12 (CNVPytor Manhattan plot):

S09_CNV

Example of the KRAKEN report showing Mycoplasm contamination in the same sample:

contamination

Example of insertion site detection, with tdTomato being found in chromosome 5 of a different sample, and possibly other transgenes (even though given the low number of matches it is more likely they are false positives due to repetitive DNA):

insertion

Tutorial

After installing SeqVerify from Bioconda, you will need to assemble the following files to run it:

  • Genome sequencing reads, in separated forward and backward FASTQ/FASTA files. SAM format files can be separated using a command like samtools fastq and then used for the pipeline. These will be referred to as r1.fq and r2.fq.
  • Reference genome, in FASTA format: the pipeline was mainly developed for CHM13, but older genomes such as HG38 were also tested with good results. This will be referred to as genome.fa.
  • Transgene/Marker genome(s), in FASTA format. This tutorial will use two transgenes (even though any number can be used), which will be referred to as transgene1.fa and transgene2.fa.
  • (If exact edits are desired) A specially-formatted commands file to indicate exact edits on the genome, information on which can be found below, which will be referred to as commands.txt.
  • (If KRAKEN is enabled) A valid KRAKEN2 database. More information about how to make a valid KRAKEN2 database can be found here.

You should then pick a directory to run the pipeline in, from which you’ll call the seqverify command. This will create two folders inside of it, the output folder and the temp folder (the latter of which will be deleted by default).

seqverify --output output_name --reads_1 r1.fastq --reads_2 r2.fastq --genome genome.fa --untargeted transgene1.fa transgene2.fa (--targeted commands.txt) (--kraken --database database)

The pipeline will then run: this will usually take a few hours, with the most time-intensive steps being BWA alignment and genome indexing. The output files as described above will be output in the output folder, and everything else in the temp folder will be deleted unless --keep_temp is set.

Command text file generation

To use the --targeted flag for known insertion sites of transposons, SeqVerify requires the construction of a commands file. The commands file should be a text file and must be formatted as follows:

CHR:START-END SEQUENCE

where the two columns are tab-separated. Every line is a “command” and specifies a modification to the genome.

CHR is the name of the chromosome that the modification will happen at (e.g. chr1).

START-END is an interval of coordinates to be deleted, not including START.

SEQUENCE is the sequence to be inserted from START onwards.

For example, the command chr5:56644830-56644850 GGCTCTGGCGAGGGCAGAGGAAGTC deletes bases 56644831 to 56644850 in chromosome 5 and inserts the sequence GGCTCTGGCGAGGGCAGAGGAAGTC in their place.

Pure insertions (i.e. inserting while deleting nothing) can be achieved by putting the same coordinate for both start and end: chr1:1-1 AGCT deletes nothing and inserts AGCT after the first base. Pure deletions (i.e. deletions with no insertions) can be achieved by leaving the sequence field blank: chr2:0-10 deletes the first 10 bases in chromosome 2 and does not replace them with anything.

Multiple commands are allowed in one command file, and seqverify automatically handles interactions between commands on the same chromosome (i.e. a command’s coordinates changing because of a previous command), so all the end user needs to do is use the coordinates straight from their source without any adjustment or calculation.

Config File

SeqVerify allows for the use of a configuration file to load all of its settings: a blank/default configuration file is bundled with a SeqVerify download under the name seqverify.config.

Please modify this file without changing the text between square brackets, as modification of the headers in the square brackets will break the file’s parsing in the pipeline.

Additionally, in the config file please make sure your untargeted insertion file names do not contain spaces: the config file parser uses spaces to separate file names, so this will cause errors in file name parsing and may result in the pipeline not running correctly.

Spurious Threshold Parameter

SeqVerify allows for a --spurious_filtering_threshold parameter to be set to control how tightly the filtering of extremely high coverage (and therefore likely spurious for actual insertions) sites is performed. Filtered areas will not be printed out in the insertion site readout, but will be printed to stdout as the pipeline is running for logging purposes.

By default, this is set to 0.00001, meaning the pipeline filters out any area with a coverage higher than what we would expect 1-0.00001 = 99.9999% of the areas in the genome to have. This feature can be turned off by setting --spurious_filtering_threshold 0, in which case no filtering will be performed and every insertion site will be reported upon.

Frequently Asked Questions

Why am I getting a BCFTools error?

Certain builds of bcftools may not be compatible with all Linux distributions. If the pipeline raises “bcftools: error while loading shared libraries: libgsl.so.25: cannot open shared object file: No such file or directory”, please try forcing Conda to use the Bioconda channel to install bcftools. You can do this by setting your .condarc file to:

channel_priority: strict
channels:
  - bioconda
  - conda-forge
  - defaults

Can multiple fastq files for the same genome be used in the same command?

No, --reads_1 and --reads_2 can each only take a single fastq file. If you have more than one fastq file for the same genome and want to use SeqVerify on your data, please concatenate all the forward reads together in one file and all the backward reads together in another file through the cat command.

Are insertions of human DNA detected in the insertion site detection portion of the pipeline?

Insertions of mitochondrial human DNA can be detected using the --mitochondrial flag. Insertions of non-mitochondrial human DNA are not currently detectable in SeqVerify, but other tools (such as IGV) can be used to find them manually.

Are insertions of mitochondrial DNA a sign of contamination/degraded data?

Not necessarily: chromosomal insertions of mitochondrial human DNA are relatively common within the human genome, and are usually not signs of contamination unless unexpectedly found at a known insertion site.

关于

用于验证和测试序列化数据一致性的工具

701.0 KB
邀请码
    Gitlink(确实开源)
  • 加入我们
  • 官网邮箱:gitlink@ccf.org.cn
  • QQ群
  • QQ群
  • 公众号
  • 公众号

版权所有:中国计算机学会技术支持:开源发展技术委员会
京ICP备13000930号-9 京公网安备 11010802047560号