目录
  1. Availability

The source code for this package is available from http://research-pub.gene.com/gmap. License terms are provided in the COPYING file.

  1. Building and installing GMAP and GSNAP

Prerequisites: a Unix system (including Cygwin on Windows), a C compiler, and Perl

Step 1: Set your site-specific variables by editing the file config.site. In particular, you should set appropriate values for “prefix” and probably for “with_gmapdb”, as explained in that file. If you are compiling this package on a Macintosh, you may need to edit CFLAGS to be

CFLAGS = ‘-O3 -m64’

since Macintosh machines will make only 32-bit executables by default.

Step 2: Build, test, and install the programs, by running the following GNU commands

./configure
make
make check   (optional)
make install

Note 1: Instead of editing the config.site file in step 1, you may type everything on the command line for the ./configure script in step 2, like this

./configure --prefix=/your/usr/local/path --with-gmapdb=/path/to/gmapdb

If you omit –with-gmapdb, it defaults to ${prefix}/share. If you omit –prefix, it defaults to /usr/local. Note that on the command line, it is “with-gmapdb” with a hyphen, but in a config.site file, it is “with_gmapdb” with an underscore.

Note 2: If you want to keep your version of config.site or have multiple versions, you can save the file to a different filename, and then refer to it like this

./configure CONFIG_SITE=<config site file>

Note 3: GSNAP is designed for short reads of a limited length, and uses a configure variable called MAX_READLENGTH (default 300) as a guide to the maximum read length. You may set this variable by providing it to configure like this

./configure MAX_READLENGTH=<length>

or by defining it in your config.site file (or in the file provided to configure as the value of CONFIG_SITE). Or you may set the value of MAX_READLENGTH as an environment variable before calling ./configure. If you do not set MAX_READLENGTH, it will have the default value shown when you run “./configure –help”.

Note that MAX_READLENGTH applies only to GSNAP. GMAP, on the other hand, can process queries up to 1 million bp.

Also, starting with version 2014-08-20, if your C compiler can handle stack-based memory allocation using the alloca() function, GSNAP ignores MAX_READLENGTH, and can handle reads longer than that value.

Note 4: GSNAP can read from gzip-compressed FASTA or FASTQ input files. This feature requires the zlib library to be present (available from http://www.zlib.net). The configure program will detect the availability of zlib automatically. However, to disable this feature, you can add “–disable-zlib” to the ./configure command or edit your config.site file to have the command “disable_zlib”.

Note 5: GSNAP can read from bzip2-compressed FASTA or FASTQ input files. This feature requires the bzlib library to be present. The configure program will detect the availability of bzlib automatically. However, to disable this feature, you can add “–disable-bzlib” to the ./configure command or edit your config.site file to have the command “disable_bzlib”.

  1. Possible issues during compilation

Recent versions of GMAP and GSNAP use certain techniques to achieve increased speed. One of these techniques is special SIMD (single-instruction, multiple data) instructions that can perform some computations in parallel. There are various levels of SIMD instructions, and we use those from the SSE2 and SSE4.1 instruction sets. Most computers built within the last 10 years should support SSE2 at least. However, you may run into the following issues:

Compiler issue 1. If you compile the code successfully, but when you run the program, you see something that says “Illegal instruction”, then you must be running GMAP or GSNAP on a different computer than the one where you compiled it. You may be using a computer cluster with a variety of different computer models. Each time you start GMAP or GSNAP, the program tests to see if the computer can run the same set of SSE2 or SSE4.1 instructions as were available when the programs were compiled. (The programs also check for if the popcnt instructions work, but popcnt is so widely implemented that they generally do not cause any problems.)

In that case, you may need to compile your program for the lowest common denominator by by providing –disable-avx, –disable-sse4.1, or –disable-sse2 to ./configure as necessary. Alternatively, your computer cluster may have the ability to detect the capabilities of each computer when it receives a job. Then, you may want to create different compiled versions of GMAP and GSNAP, and call the appropriate binary for that particular job. You will have to work with your system administrator if you want to accomplish this.

Compiler issue 2. The most recent versions of GSNAP (starting with 2013-10-01) build a suffix array to help with speed. If your computer does not have sufficient RAM, it is possible that the gmap_build step fails after printing something like this:

SACA_K called with n = 3095693984, K = 5, level 0

If this happens, you either need to find a computer with more RAM, or you can build a genome without a suffix array, by providing –no-sarray to gmap_build. The GSNAP program will still work with the resulting genome index, but it won’t achieve optimal speed. GMAP does not use the suffix array at all. Also, large genomes of over 4 billion bp also will not create or use a suffix array.

  1. Downloading a pre-built GMAP/GSNAP database

A GMAP/GSNAP “database” is a set of genomic index files, representing the genome in a hash table format. You can use the gmap_build program to build your own database (as described below), but you can started quickly by downloading a pre-built GMAP/GSNAP database from the same place you obtained the GMAP program (see above for URL).

Place the database in the GMAPDB directory you specified in the config.site file when you built the gmap program. You should include a subdirectory for each GMAP database; for example, if you downloaded a database called , your directory structure should look like this

/path/to/gmapdb/<genome>/
/path/to/gmapdb/<genome>/<genome>.chromosome
/path/to/gmapdb/<genome>/<genome>.chromosome.iit
...
/path/to/gmapdb/<genome>/<genome>.version

Note that the GMAP database format has changed with the 2013-10-01 release to add a suffix array and other new file formats. However, GMAP and GSNAP are both backwards and forwards compatible, meaning that new source code will work with older genome indices and that old source code will work with newer genome indices. Mixing up the two, though, will result in slower running speed. To achieve optimal speed, you should use both the latest source code and rebuild your genome indices with the latest gmap_build program. You can tell if your database has the most recent format if it has files of the type .sarray, .ref12153bitpackptrs, and .ref12153bitpackcomp.

Note that the hg19 database provided on the Web site lacks the suffix array, although GMAP and GSNAP will work fine, albeit more slowly. The suffix array for hg19 requires 15 GB of disk space. If you want the suffix array, you will have to build it yourself, as discussed in the next section.

  1. Setting up to build a GMAP/GSNAP database (one chromosome per FASTA entry)

You can also build your own genomic database, using the gmap_build program provided with this package. (Note: the gmap_setup method from older versions is no longer provided or supported.)

Previous versions limited the total sequence length in your database to 2^32 = 4,294,967,296 (about 4 billion) bp. However, starting with version 2013-04-01, a total “genome” may now contain up to 2^64 bp. However, each individual chromosome is still limited to 2^32 bp. The utility programs below will automatically recognize when a genome is larger than 2^32 bp and build the index files accordingly. Below I use the “genome” and “chromosome”, but the input sequences can be anything you wish to align to, including transcripts or small fragments.

You will need to start with a set of FASTA files containing either entire chromosomes or contigs that represent pieces of chromosomes. For example, for the human genome, you can retrieve all of the FASTA files under the ftp directory at

ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/chromosomes/

If your FASTA entries each contain a single chromosome, and the accession for each chromosome is the chromosome number/letter, you can simply run this command

gmap_build -d <genome> [-k <kmer size>] <fasta_files...>

which will build and install the GMAP index files in your default GMAPDB location.

You can see the full usage of gmap_build by doing “gmap_build –help”, but here are some useful flags. If your FASTA files are compressed using gzip, you can add the flag “-g” to gmap_build. You can control the k-mer size for the genomic index with the -k flag, which can range from 12 to 15. The default value for -k is 15, but this requires your machine to have 4 GB of RAM to build the indices. If you do not have 4 GB of RAM, then you will need to reduce the value of -k or find another machine. Here are the RAM requirements for building various indices:

k-mer of 12: 64 MB
k-mer of 13: 256 MB
k-mer of 14: 1 GB
k-mer of 15: 4 GB

These are the RAM requirements for building indices, but not to run the GMAP/GSNAP programs once the indices are built, because the genomic indices are compressed. For example, the genomic index for a k-mer of 15 gives a gammaptrs file of 64 MB and an offsetscomp file of about 350 MB, much smaller than the 4 GB that would otherwise be required. Therefore, you may want to build your genomic index on a computer with sufficient RAM, and distribute that index to be used by computers with less RAM.

The amount of compression can be controlled using the -b or –basesize parameter to gmap_build. By default, the value for k-mer size is 15, and the value for basesize is 12. If you select a different value for k-mer size, then basesize is made by default to be equal to that k-mer size.

If you want to build your genomic databases with more than one k-mer size, you can re-run gmap_build with different values of -k. This will overwrite only the identical files from the previous runs. You can then choose the k-mer size at run-time by using the -k flag for either GMAP or GSNAP.

Finally, you can provide information to gmap_build that certain chromosomes are circular, with the -c or –circular flag. The value for these flags is a list of chromosomes, separated by commas. The gmap_build program will then allow GSNAP and GMAP to align reads across the ends of the chromosome. For example, the mitochondrial genome in human beings is circular.

  1. Setting up to build a GMAP/GSNAP database (more complex cases)

If you are indexing a genome, where each chromosome is contained in a separate FASTA entry, or a set of contigs, where the contigs are independent of each other, then you can just skip to section 6. Otherwise, if you have more complicated needs, you may need to add options to gmap_build.

Note that the term

<fasta_file>... 

above indicates that multiple files can be listed. The files can be in any order, and the contigs can be in any order within these files. By default, the gmap_build process will sort the contigs and chromosomes into their appropriate “chrom” order. For the human genome, this order is 1, 2, …, 10, 11, …, 22, X, Y, M, followed by all other chromosomes in numeric/alphabetical order. If you don’t want this sort, provide the “-s none” flag to gmap_build. Other sort options besides “none” and “chrom” are “alpha” and “numeric-alpha”.

You can type “gmap_build –help” to see the full set of options. We discuss some specific situations below.

5a. Contigs are mapped to chromosomes

If your FASTA entries consist of contigs, each of which has a mapping to a chromosomal region in the header, you may add the -C (or –contigs-are-mapped) flag to gmap_build, like this

gmap_build -d <genome> -C <fasta_file>...

Then gmap_build will try to parse a chromosomal region from each header. The program knows how to parse the following patterns:

chr=1:217281..257582  [may insert spaces around '=', or omit '=' character]
chr=1                 [may insert spaces around '=', or omit '=' character]
chromosome 1                                                         [NCBI .mfa format]
chromosome:NCBI35:22:1:49554710:1                                    [Ensembl format]
/chromosome=2                                                        [Celera format]
/chromosome=2 /alignment=(88840247-88864134) /orientation=rev        [Celera format]
chr1:217281..257582
chr1                  [may insert spaces after 'chr']

If only the chromosome is specified, without coordinates, the program will assign its own chromosomal coordinates by concatenating the contigs within each chromosome. If gmap_build cannot figure out the chromosome, it will assign it to chromosome “NA”.

5b. Using an MD file

Another possibility is that your FASTA entries consist of contigs that mapped to chromosomes, where the mapping information is in an external file. Genomes from NCBI typically include an “.md” file (like seq_contig.md) that specifies the chromosomal coordinates for each contig. To use this information, provide the -M (or –mdfile) flag to gmap_build like this

gmap_build -d <genome> -M <mdfile> <fasta_file>...

The program will then try to parse the mdfile (which often changes formats) and verify with you which columns contain the contig names and chromosomal coordinates.

5c. Compressed FASTA files or files requiring processing

If your genome files are compressed using gzip, you can simply add the flag “-g” to gmap_build. But if your genome files require some other type of processing, you may need to write a small script that pipes the sequences in FASTA format to gmap_build. You can tell gmap_build about your script with the -E (or –fasta-pipe) flag, like this

gmap_build -d <genome> -E 'gunzip -c chr*.gz'
gmap_build -d <genome> -E 'cat *.fa | ./add-chromosomal-info.pl'

You can think of the command as a Unix pipe for processing each FASTA file before it is read by gmap_build.

  1. Running GMAP

To see the full set of options, type “gmap –help”. The following are some common examples of usage. For more examples, see the document available at http://www.gene.com/share/gmap/paper/demo-slides.pdf

For each of the examples below, we assume that you have installed a genome database called in your GMAPDB directory. (If your database is located elsewhere, you can specify the -D flag to gmap or set the environment variable GMAPDB to point to that directory.)

  • Mapping only: To map one or more cDNAs in a FASTA file onto a genome, run GMAP as follows:

    gmap -d

  • Mapping and alignment: If you want to map the cDNAs to a genome, and show the full alignment, provide the -A flag:

    gmap -d -A

  • Alignment only: To align one or more cDNAs in a FASTA file onto a given genomic segment (also in a FASTA file), use the -g flag instead of the -d flag:

    gmap -g -A

  • Batch mode: If you have a large number of cDNAs to run, and you have sufficient RAM to run in batch mode, add the “-B 3”, “-B 4”, or “-B 5” option. Details for these options are provided by running “gmap –help”.

    gmap -d -B 5 -A

  • Multithreaded mode: If your machine has several processors, you can make batch mode run even faster by specifying multiple threads with the -t flag:

    gmap -d -B 5 -A -t

    Note that with multiple threads, the output results will appear in random order, depending on which thread finishes its computation first. If you wish your output to be in the same order as the input cDNA file, add the ‘-O’ (letter O, not the number 0) flag to get ordered output.

    Guidelines: The -t flag specifies the number of computational threads. In addition, if your machine supports threads, GMAP also uses one thread for reading the input query sequences, and one thread for printing the output results. Therefore, the total number of threads will be 2 plus the number you specify. The program will work optimally if it uses one thread per available processor. If you specify too many threads, you can cause your computer to thrash and slow down. Note that other programs running on your computer also need processors.

  • Compressed output: If you want to store the alignment results in a compressed format, use the -Z flag. You can uncompress the results by using the gmap_uncompress.pl program:

    gmap -d -Z > x cat x | gmap_uncompress

Note that gmap is written for small genomes (less than 2^32 bp in total length). With large genomes, there is an equivalent program called gmapl, which you should run instead of gmap. The gmapl program is equivalent to gmap, and is based on the same source code, but is compiled to use 64-bit index files instead of 32-bit files. The gmap and gmapl programs will detect whether the genomes are the correct size, and will exit if you try to run them on the wrong-sized genomes.

  1. Building map files

This package includes an implementation of interval index trees (IITs), which permits efficient lookup of interval information. The gmap program also allows you (with its -m flag) to look up pre-mapped annotation information that overlaps your query cDNA sequence. These interval index trees (or map files) are built using the iit_store program included in this package. To build a map file, do the following:

Step 1: Put your map information for a given genome into a map file with the following FASTA-like format:

>label coords optional_tag
optional_annotation (which may be zero, one, or multiple lines)

For example, the label may be an EST accession, with the coords representing its genomic position. Labels may be duplicated if necessary.

The coords should be of the form

chr:position
chr:startposition..endposition

The term “chr:position” is equivalent to “chr:position..position”. If you want to indicate that the interval is on the minus strand or reverse direction, then may be less than .

Tags are very general and can be used for a variety of purposes. For example, you could

Step 2: Run iit_store on this map file as follows

cat <mapfile> | iit_store -o <mapname>

The program will create a file called .iit.

Now you can retrieve this information with iit_get

iit_get <mapname>.iit <coords>

where has the format “chr:position” or “chr:startposition..endposition”. The iit_get program has other capabilities, including the ability to retrieve information by label, like this:

iit_get <mapname>.iit <label>

More details can be found by running “iit_get –help”.

If you plan to use this map information frequently, you may want to place it with its corresponding genome for future use. In each GMAP/GSNAP database, there is a subdirectory for storing map files, like this

/path/to/gmapdb/<genome>/<genome>.maps/

(If you don’t remember where your default gmap directory is, run “gmap –version” to find it.) If you put your .iit file into this maps subdirectory, you can get additional functionality. First, you can run the program get-genome, which is used mainly for getting genome sequence, to get map information instead, like this

get-genome -d <genome> -m <mapname> <coords>

Second, you can use GMAP with the -m flag to retrieve map information that corresponds to a given cDNA sequence like this

gmap -d <genome> -m <mapname> <cdna_file>

Finally, GMAP and the IIT utilities support the GFF3 format. GMAP can generate its results in GFF3 format, and iit_store can parse GFF3 files using its -G and -l flags. More details about iit_store can be found by doing “iit_store –help”.

  1. Running GSNAP

GSNAP uses the same database as GMAP does, so you will need to process the genome using gmap_build as explained above, if you haven’t done that already.

To see the full set of options for GSNAP, type “gsnap –help”. A key parameter you will need to set is the “-m” flag, which is the maximal score you will allow per read (or each end of a paired-end read). The score equals the number of mismatches, plus penalties for indels and local or distant splicing, if any. If you do not set a value for “-m”, then GSNAP will pick a value, depending on the length of each read, that will allow it to run fairly quickly.

For DNA-Seq, the automatic setting should be fine, unless you need to accommodate penalty values for indels or splicing, or your reads are of poor quality.

For RNA-Seq, in previous versions, we recommended a moderately high value of -m, such as 10 or so, to handle alignments that cross an intron-exon boundary. But now that GSNAP can find terminal alignments and has GMAP integrated in its algorithm, it is better to select a small value for -m, such as the default value or something small like 4 or 5 for a 75-bp read.

Input to GSNAP should be either in FASTQ or FASTA format. The FASTQ input may include quality scores, which will then be included in SAM output, if that output format is selected. For single-end reads, the FASTQ file may be piped into GSNAP, or given as its command-line argument, like this

cat <fastq_file> | gsnap -d <genome>

or

gsnap -d <genome> <fastq_file>

For paired-end reads, the two corresponding FASTQ files should be given as command-line arguments in pairs, like this

gsnap -d <genome> <fastq_file_1> <fastq_file_2> [<fastq_file_3> <fastq_file_4>...]

A pipe cannot work since GSNAP needs to access both FASTQ files in parallel. The reads in FASTQ files may have varying lengths, if desired. Note that GSNAP can process multiple sets of paired-end reads, by adding the files in pairs. If you want to provide multiple single-end files, you can either use “cat” to concatenate them into the stdin of gsnap, like this:

cat <fastq_file_1> [<fastq_file_2>...] | gsnap -d <genome>

or you can provide them all on the command line with the –force-single-end flag, like this:

gsnap -d <genome> --force-single-end <fastq_file_1> [<fastq_file_2>...]

which will process each FASTQ file one at a time as single-end reads, and not try to pair them up.

GSNAP also has the ability to deal with files compressed with gzip, if the configure script at compile time can find a zlib library in your system (see Note 3 in the section above about building and installing GMAP and GSNAP). If so, and your files are gzipped, you can then read in gzipped files directly like this

gsnap --gunzip -d <genome> <fastq.gz>, or 
gsnap --gunzip -d <genome> --force-single-end <fastq1.gz> [<fastq2.gz>...]

for single-end reads, or

gsnap --gunzip -d <genome> <fastq_1.gz> <fastq_2.gz> [<fastq_3.gz> <fastq_4.gz>...]

for paired-end reads.

Likewise, GSNAP can handle files compressed with bzip2, if the configure script at compile time can find a bzlib library in your system (see Note 3 in the section above about building and installing GMAP and GSNAP). If so, and your files are bzip2-compressed, you can then read in those files directly like this

gsnap --bunzip2 -d <genome> <fastq.bz2>, or 
gsnap --bunzip2 -d <genome> --force-single-end <fastq1.bz2> [<fastq2.bz2>...]

for single-end reads, or

gsnap --bunzip2 -d <genome> <fastq_1.bz2> <fastq_2.bz2> [<fastq_1.bz2> <fastq_2.bz2>...]

for paired-end reads.

For FASTA format, you should include one line per read (or end of a paired-end read). The same FASTA file can have a mixture of single-end and paired-end reads of varying lengths, if desired.

Single-end reads:

Each FASTA entry should contain one short read per line, like this

Header information AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA

Each short read can have a different length. However, the entire read needs to be on a single line, and may not wrap around multiple lines. If it extends to a second line, GSNAP will think that the read is paired-end.

Paired-end reads:

Each FASTA entry should contain two short reads, one per line, like this

Header information AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG

By default, the program assumes that the second end is in the reverse complement direction compared with the first end. If they are in the same direction, you may need to use the –circular-input (or -c) flag.

GSNAP and GMAP can also read an extended FASTA format that include quality scores, which look like this

>Header information
AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA
+
<quality scores>

for single-end reads, or

<Header information
AAAACATTCTCCTCCGCATAAGCCTGCGTCAGATTA
+
<quality scores>

for the second-end of a paired-end read. In addition, GSNAP can read an extended FASTA format for paired-end reads, like this:

>Header information
AAAACATTCTCCTCCGCATAAGCCTAGTAGATTA
GGCGTAGGTAGAAGTAGAGGTTAAGGCGCGTCAG
+
<quality scores 1>
<quality scores 2>

This extended FASTA format is useful if paired-end information needs to be piped into GSNAP via stdin.

As with gmap, gsnap is written for small genomes (less than 2^32 bp in total length). With large genomes, there is an equivalent program called gsnapl, which you should run instead of gsnap. The gsnapl program is equivalent to gmap, and is based on the same source code, but is compiled to use 64-bit index files instead of 32-bit files. The gsnap and gsnapl programs will detect whether the genomes are the correct size, and will exit if you try to run them on the wrong-sized genomes.

  1. SAM output format

GSNAP can generate SAM output format, by providing the “-A sam” flag to GSNAP. In addition, GMAP can also print its alignments in SAM output, using the “-f samse” or “-f sampe” options, for single-end or paired-end data. The sampe option will generate SAM flags to indicate whether the read is the first or second end of a pair, which requires that you provide GMAP with an extended FASTA format having a “>” or “<” character in the header to indicate that information. However, the sampe option will change only the SAM flags, and not change the underlying alignment algorithm. GMAP does not know how to find concordance between paired-end reads like GSNAP does.

GSNAP provides some special SAM flags as follows:

XQ: A non-normalized mapping quality score

X2: The second best XQ score among all multimapping alignments for a given read. If there is only a single alignment, this value is 0.

XO: Output type. GSNAP categorizes its alignments into output types, as follows. Note that the –split-output option will create separate output files for each output type. Alternatively, if you use sam_sort, you should provide –split-output to that program instead and achieve the same functionality. (The reason for this is that there may be situations where GSNAP assigns different output types to the first and second ends of the reads and sam_sort needs to see alignments from both ends together.) In either case, the output types have the following meanings and filename suffixes:

NM (nomapping) (filename suffix “.nomapping”): The entire read (single-end or paired-end) could not be aligned. If the –failed-input=FILENAME flag is specified, then these reads are also printed in FASTQ or FASTA format (depending on the input format) in the given file (plus a .1 or .2 ending for the first and second ends of a paired-end read).

CU (concordant unique) (filename suffix “.concordant_uniq”): Both ends of a paired-end read could be aligned concordantly to a single position in the genome. For a definition of concordance, see the section “Output types” below.

CM (concordant multiple) (filename suffix “.concordant_mult”): Both ends of a paired-end read could be aligned concordantly, but to more than one position in the genome.

CX (concordant multiple excess) (filename suffix “.concordant_mult_xs”): Multiple concordant alignments, but user specified –quiet-if-excessive and the number of alignments exceeds “-n” threshold. If the –failed-input option is given, these reads are also printed in FASTA or FASTQ format in the given file.

CT (concordant translocation) (filename suffix “.concordant_transloc”): Both ends of a paired-end read could be aligned concordantly, but one end requires a split alignment to a distant location, such as another chromosome, or a different strand on that chromosome, or a far distance on that strand. Note that translocation alignments need to be printed on two separate SAM lines.

CC (concordant circular) (filename suffix “.concordant_circular”): Both ends of a paired-end read could be aligned concordantly, but one or both ends require an alignment that goes around the origin of a circular chromosome. Circular chromosomes are specified in the gmap_build step by using the -c or –circular flag, as described previously. Note that circular alignments need to be printed on two separate SAM lines.

PI (paired unique inversion) (filename suffix “.paired_uniq_inv”): Both ends of a paired-end read could be aligned uniquely, but in a way that indicates that a genomic inversion has occurred between the two ends.

PS (paired unique scramble) (filename suffix “.paired_uniq_scr”): Both ends of a paired-end read could be aligned uniquely, but in a way that indicates that the genomic order is scrambled. This typically occurs because of tandem duplications.

PL (paired unique long) (filename suffix “.paired_uniq_long”): Both ends of a paired-end read could be aligned uniquely, but in a way that indicates that a large genomic deletion has occurred between the two ends.

PC (paired unique circular) (filename suffix “.paired_uniq_circular”): Both ends of a paired-end read could be aligned uniquely, but not concordantly, representing an inversion, scramble, or deletion. In addition, one or both ends of the read goes around the origin of a circular chromosome.

PM (paired multiple) (filename suffix “.paired_mult”): Both ends of a paired-end read could be aligned near each other, representing an inversion, scramble, or deletion, but there are multiple places in the genome where an alignment is found.

PX (paired multiple excess) (filename suffix “.paired_mult_xs”): Multiple paired alignments, but user specified –quiet-if-excessive and the number of alignments exceeds the “-n” threshold. If the –failed-input option is given, these reads are also printed in FASTA or FASTQ format in the given file.

HU, HM, HT, HC (halfmapping unique, halfmapping multiple, halfmapping translocation, and halfmapping circular, respectively) (filename suffixes: “.halfmapping_uniq”, “.halfmapping_mult”, “.halfmapping_transloc”, “.halfmapping_circular): Same as for the concordant output types, except that only one end of the paired-end read could be aligned, and the other end could not be aligned anywhere in the genome.

HX (halfmapping multiple excess) (filename suffix “.halfmapping_mult_xs”): Multiple halfmapping alignments, but user specified –quiet-if-excessive and the number of alignments exceeds the “-n” threshold. If the –failed-input option is given, these reads are also printed in FASTA or FASTQ format in the given file.

UU, UM, UT, UC (unpaired unique, unpaired multiple, unpaired translocation, and unpaired circular, respectively) (filename suffixes: “.unpaired_uniq”, “.unpaired_mult”, “.unpaired_transloc”, “.unpaired_circular): Same as for the concordant output types, except that the two ends could not be aligned concordantly or even paired. These “unpaired” categories are also used for single-end reads, since they lack a mate end that can allow for concordance, pairing, or halfmapping.

UX (unpaired multiple excess) (filename suffix “.unpaired_mult_xs”): Multiple unpaired alignments, but user specified –quiet-if-excessive and the number of alignments on one end exceeds the “-n” threshold. If the –failed-input option is given, these reads are also printed in FASTA or FASTQ format in the given file.

XB: Prints the barcode extracted from the end of the read. Applies only if –barcode-length is not 0.

XP: Prints the primer inferred from a paired-end read. Applies only if the –adapter-strip flag is specified.

XH: Prints the part of the query sequence that was hard-clipped. Sequence is printed in plus-genomic order and replaces the “H” part of the CIGAR string.

XI: Prints the part of the quality string that was hard-clipped. Sequence is printed in plus-genomic order and replaces the “H” part of the CIGAR string.

XS: Prints the strand orientation (+ or -) for a splice. Appears only if splicing is allowed (-N or -s flag provided), and only for reads containing a splice. The value “+” means the expected GT-AG, GC-AG, or AT-AC dinucleotide pair is on the plus strand of the genome, and “-“ means the dinucleotides are on the minus strand. If the orientation is not obvious, because the dinucleotides do not match GT-AG, GC-AG, AT-AC, or their complements, then the program applies a probabilistic splice model to determine the orientation. If the splice sites have low probability, then the program may not be able to determine an orientation, and the result will be printed as XS:A:?. To prevent this flag, which cannot be handled by such programs (such as Cufflinks), use the –force-xs-dir flag. However, this flag will merely change occurrences of XS:A:? arbitrarily to XS:A:+.

XA: Indicates an ambiguous splice. If GSNAP finds two or more possible splices at a given position, it will try to resolve the ambiguity if possible based on the other end of the paired-end read. If the ambiguity cannot be resolved, GSNAP will not report any of the splices, but will report a soft clip instead. The XA field indicates which end or ends are ambiguous and the number of matches found on each ambiguous end, based on the output XA:Z:i,j. If i or j is greater than 0, that indicates that the lower or higher chromosomal end is ambiguous, respectively. The value given indicates the number of matches found in the ambiguous end. This number may be smaller than the number of bases soft-clipped, due to mismatches.

XC: Indicates whether the alignment crosses over the origin of a circular chromosome. If so, the string XC:A:+ is printed.

XT: Prints the intron dinucleotides and splice probabilities around a distant splicing event (genomic deletion, inversion, scramble, or translocation).

XW and XV: Printed only when SNP-tolerant alignment is enabled. XW provides the number of mismatches against both the reference and alternate alleles (or the “World” population). Therefore, these are true mismatches. XV provides the number of positions that are mismatches against the reference genome, but do match the alternate genome. Therefore, these are known variant positions. The sum of XW and XV provides the number of differences relative to the reference genome, and with the exception of indels, should equal the value of NM.

XG: Indicates which method within GSNAP generated the alignment. A: suffix array method, B: GMAP alignment produced from suffix array, M: GMAP alignment produced from GSNAP hash table method, T: terminal alignment, O: merging of overlaps. Absence of XG flag indicates the standard GSNAP hash table method. (Note: older versions of GSNAP used “PG:”, but some downstream software required all PG methods to be listed in the header section, so we changed the field name to “XG:”)

  1. GSNAP output format

By default, GSNAP prints its output in a FASTA-like format, which we developed before we incorporated the SAM format. The default GSNAP output has some advantages over SAM output, especially for debugging purposes. However, we routinely use SAM output for our own pipeline, and it has been subject to the most testing by ourselves and by outside users.

Here is some output from GSNAP on a paired-end read:

GGACTGCGCACCGAACGGCAGCGACTTCCCGTAGTAGCGGTGCTCCGCGAAGACCAGTAGAGCCCCCCGCTCGGCC 1 concordant ILLUMINA-A1CCE9_0004:1:1:1510:2090#0 GGACTGCGCACCGAACGGCAGCGACTTCCCGTAGTAGCGct———————————– 1..39 +9:139128263..139128301 start:0..acceptor:0.99,dir:antisense,splice_dist:214,sub:0+0=0,label:NM_013379.DPP7.exon4/13 segs:2,align_score:2 pair_score:5,pair_length:112 ,————————————-acGTGCTCCGCGAAGACCAGTAGAGCCCCCCGCTCGGCC 40..76 +9:139128516..139128552 donor:0.96..end:0,dir:antisense,splice_dist:214,sub:0+0=0,label:NM_013379.DPP7.exon3/13

<CTTCGCCAACAACTCGGGCTTCGTCGCGGAGCTGGCGGCCGAGCGGGGGGCTCTACTGGTCTTCGCGGAGCACCGC 1 concordant ILLUMINA-A1CCE9_0004:1:1:1510:2090#0 CTTCGCCAACAACTCGGcCTTCGTCGCGGAGCTGGCGGCCGAGCGGGGGGCTCTACTGGTCTTCGCGGAGCACgtg 1..73 -9:139128588..139128516 start:0..end:3,sub:3+1=4 segs:1,align_score:3 pair_score:5,pair_length:112

Each end of a read gets its own block, with the first read starting with “>” and the second read for paired-end reads starting with “<”. The block starts with a header line that has in column 1, the query sequence in its original direction (and with lower-case preserved if any); in column 2, the number of hits for that query and if the read is paired-end, the relationship between the ends (as discussed in the next paragraph); and in column 3, the accession number for the query.

  1. Output types

The two ends of a paired-end read can have the following relationships: “concordant”, “paired”, or “unpaired”. A paired-end read is concordant if the ends align to the same chromosome, in the expected relative orientations, and having an inferred insert length greater than zero and within the “–pairmax” parameter. The inferred insert length is the distance from the end of the first-end alignment to the start of the second-end alignment, plus the read lengths of the two ends. There may be more than one concordant alignment for a given read, and if so, the alignments for each end are reported in corresponding order.

If a concordant relationship cannot be found, then the program will report any paired relationships it can find. A paired alignment occurs when the two ends align to the same chromosome, but fail some criterion for concordance. There are different subtypes of paired alignments, depending on which criterion is violated. If the orientations are opposite what is expected, the paired subtype is “inversion”. If they are in the expected orientation, but the distance is greater than the “–pairmax” parameter, then the paired subtype is “toolong”. If they are in the expected orientation, but the inferred insert length appears to be negative, then the paired subtype is “scramble”. In GSNAP output, a paired subtype is shown in a label called “pairtype”, which can have the values “pairtype:inversion”, “pairtype:toolong”, and “pairtype:scramble”.

Otherwise, if neither a concordant nor paired alignment can be found, then the program will align each end separately, and report the relationship as being “unpaired”.

GSNAP can find translocation splices within a single end of a read, but it tries to be conservative about reporting them. If there is any alignment that does not involve such a translocation, then it will not report the translocation. It therefore reports translocation splices only when no other alignment is found within the concordant, paired, or unpaired categories. Therefore, such results are listed in the header as having “(transloc)” appear after the “concordant”, “paired”, or “unpaired” result type.

After the query line, each of the genomic hits is shown, up to the ‘-n’ parameter. If too many hits were found (more than the ‘-n’ parameter), the behavior depends on whether the “–quiet-if-excessive” flag is given to GSNAP. If not, then the first n hits will be printed and the rest will not be printed. If the “–quiet-if-excessive” flag is given to GSNAP, then no hits will be printed if the number exceeds n.

Each of the genomic hits contains one or more alignment segments, which is a region of continuous one-to-one correspondence (matches or mismatches) between the query and the genome. Multiple segments occur when the alignment contains an insertion, deletion, or splice. The first segment is marked by a space (“ “) at the beginning of the line, while the second and following segments are marked by a comma (“,”) at the beginning of the line. (In the current implementation of GSNAP that allows only a single indel or splice, the number of segments is at most two.)

The segments contain information in tab-delimited columns as follows:

Column 1: Genomic sequence with matches in capital letters, mismatches in lower-case letters, and regions outside the segment with dashes. For deletions in the query, the deleted genomic sequence is also included in lower case. For spliced reads, the two dinucleotides at the intron ends are included in lower case.

Column 2: Range of query sequence aligned in the segment. Coordinates are inclusive, with the first nucleotide considered to be position 1.

Column 3: Range of genomic segment aligned, again with inclusive coordinates, with the first nucleotide in each chromosome considered to be position 1. Plus and minus strands are marked with a “+” or “-“ sign.

Column 4: Segment information, delimited by commas. The first item reports on the ends of the segment, which can be of type “start”, “end”, “ins”, “del”, “donor”, “acceptor”, or “term”. After “start” and “end”, we report the number of nucleotides clipped or trimmed from the segment. In our example above, “end:3” means that 3 nucleotides should be trimmed from the end. Trimming finds a local maximum of matches to mismatches from the end and is computed only if the “-T” flag is specified, and the value for “-T” limits the amount of trimming allowed. After “ins” and “del”, we report the number of nucleotides that were inserted or deleted in the query relative to the genome. After “donor” or “acceptor”, we report the probability of the splice site, based on the MaxEnt model. The “term” label indicate a terminal segment, where the entire read could not be aligned, but more than half of the read could be aligned from either end.

Each segment will also show after the “sub” tag, he number of mismatches in that segment including the part that is trimmed, if any. If SNP-tolerant alignment is chosen, then the number of SNPs is also shown (see details below under SNP-tolerant alignment). Other information may also be included with the segment information, such as the orientation and distance of the splice or known splice labels, if appropriate flags and information are given to GSNAP. Splices are marked with a splice_type, which can be “consistent”, “inversion”, “scramble”, or “translocation”. A “translocation” splice includes splices on the same chromosome where the splice distance exceeds the parameter for localsplicedist.

Column 5: Alignment or hit information, delimited by commas. For the first segment in a hit (the one starting with a space), this column provides the number of segments (denoted by “segs:”) and the score of the alignment (denoted by “align_score:”).

Column 6: Pair information (for paired-end reads only). For the first segment in a hit (with the same information repeated on both ends of a concordant pair), this column provides the score of the pair (which is the sum of the alignment scores) and the inferred length of the insert (ignoring splices within each segment, but not between segments).

  1. Detecting known and novel splice sites in GSNAP

GSNAP can detect splice junctions in individual reads. You can detect splices using a probabilistic model using the –novelsplicing (or -N) flag. You can also detect splices from a set of splice sites that you provide, using the –splicesites (or -s) flag. You may specify both flags, which will report splice junctions involving both known and novel sites.

Output for a splicing junction will look like this:

TCCGTGACGTGGATTGGTGCTGCACCCCTCATC 1 Header TCCGTGACGTGGATTGgt————— 1..16 +19:56050054..56050069 start:0..donor:0.99,splice_dist:1238,dir:sense,sub:0+0=0,label:NM_001648.KLK3.exon1/5|NM_001030047.KLK3.exon1/5|NM_001030048.KLK3.exon1/5|NM_001030049.KLK3.exon1/6|NM_001030050.KLK3.exon1/2
,————–agGTGCTGCACCCCTCATC 17..33 +19:56051308..56051324 acceptor:0.99..end:0,dir:sense,sub:0+0=0,label:NM_001648.KLK3.exon2/5|NM_001030047.KLK3.exon2/5|NM_001030048.KLK3.exon2/5|NM_001030049.KLK3.exon2/6|NM_001030050.KLK3.exon2/2

After the “donor:” or “acceptor:” splice site type, the model score probability is given, even if the splice site is known. For known splice sites, the “label:” field will provide information about the site. If there is more than one known splice site at a genomic position, the labels are separated by a “|” delimiter.

There are several advantages to specifying a database of known splice sites. First, GSNAP will then be able to detect splicing involving atypical splice sites, that would otherwise give low scores using its probabilistic model. A known splice site is treated as if its model probability is 1.0. Second, GSNAP can find splicing involving short exons. Such cases have a single end aligning to three exons, separated by two introns. Third, GSNAP can identify splicing at the ends of reads with greater sensitivity, even if they have short overlaps onto the next exon. Fourth, GSNAP can detect known long splices, because expected splice lengths can be included with the splice site information.

GSNAP allows for known splicing at two levels: at the level of known splice sites and at the level of known introns. At the site level, GSNAP finds splicing between arbitrary combinations of donor and acceptor splice sites, meaning that it can find alternative splicing events. At the intron level, GSNAP finds splicing only between the set of given donor-acceptor pairs, so it is constrained not to find alternative splicing events, only introns included in the given list. For most purposes, I would recommend using known splice sites, rather than known introns, unless you are certain that all alternative splicing events are known are represented in your file.

GSNAP can tell the difference between known site-level and known intron-level splicing based on the format of the input file. To perform known site-level splicing, you will need to create a file with the following format:

NM_004448.ERBB2.exon1 17:35110090..35110091 donor 6678 NM_004448.ERBB2.exon2 17:35116768..35116769 acceptor 6678 NM_004448.ERBB2.exon2 17:35116920..35116921 donor 1179 NM_004448.ERBB2.exon3 17:35118099..35118100 acceptor 1179 NM_004449.ERG.exon1 21:38955452..38955451 donor 783 NM_004449.ERG.exon2 21:38878740..38878739 acceptor 783 NM_004449.ERG.exon2 21:38878638..38878637 donor 360 NM_004449.ERG.exon3 21:38869542..38869541 acceptor 360

Each line must start with a “>” character, then be followed by an identifier, which may have duplicates and can have any format, with the gene name or exon number shown here only as a suggestion. Then there should be the chromosomal coordinates which straddle the exon-intron boundary, so one coordinate is on the exon and one is on the intron. (Coordinates are all 1-based, so the first character of a chromosome is number 1.) Finally, there should be the splice type: “donor” or “acceptor”. You may optionally store the intron distance at the end. GSNAP can use this intron distance, if it is longer than its value for –localsplicedist, to look for long introns at that splice site. The same splice site may have different intron distances in the database; GSNAP will use the longest intron distance reported in searching for long introns.

Note that the chromosomal coordinates are in the sense direction. Therefore, genes on the plus strand of the genome (like NM_004448) have the coordinates in ascending order (e.g., 35110090..35110091). Genes on the minus strand of the genome (like NM_004449) have the coordinates in descending order (e.g., 38955452..38955451).

On the other hand, to perform known intron-level splicing, you will need to create a file with the following format:

NM_004448.ERBB2.intron1 17:35110090..35116769 NM_004448.ERBB2.intron2 17:35116920..35118100 NM_004449.ERG.intron1 21:38955452..38878739 NM_004449.ERG.intron2 21:38878638..38869541

Again, coordinates are 1-based, and specify the exon coordinates surrounding the intron, with the first coordinate being from the donor exon and the second one being from the acceptor exon.

There are several ways to help you generate these files. First, if you have a GTF file, you can use the included programs gtf_splicesites and gtf_introns like this:

cat <gtf file> | gtf_splicesites > foo.splicesites
cat <gtf file> | gtf_introns > foo.introns

Second, if you retrieve an alignment tracks from UCSC, like this:

ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/refGene.txt.gz

if you are aligning to genome hg18, or

ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/database/refGene.txt.gz

if you are aligning to genome hg19, you can process this track using the included program psl_splicesites or psl_introns, like this:

gunzip -c refGene.txt.gz | psl_splicesites -s 1 > foo.splicesites
gunzip -c refGene.txt.gz | psl_introns -s 1 > foo.introns

Note that alignment tracks in UCSC sometimes have an extra column on the left. The “-s” flag allows you to indicate how many columns should be skipped.

Once you have built this splicesites or introns file, you process it as a map file (see “Building map files” above), by doing

cat foo.splicesites | iit_store -o <splicesitesfile>, or
cat foo.introns | iit_store -o <intronsfile>

If you want to include more than one track, you can do this:

gunzip -c refGene.txt.gz | psl_splicesites -s 1 > foo
gunzip -c knownGene.txt.gz | psl_splicesites > bar
cat foo bar | iit_store -o <splicesitesfile>

A third way to build a known splicesites or known introns file is useful if you have cDNA sequences rather than an alignment track, or if you do not trust the alignment track and prefer to use cDNA sequences. GMAP has an option “-f splicesites” that finds splice sites in cDNA sequences and reports them in the correct splicesite format. Likewise, GMAP can build an intron file, with the option “-f introns”.

When processing known cDNA sequences, you should also run GMAP with the “-n 1” flag, so you get the best alignment, and with the “-z sense_force” or “-z sense_filter” flag. The sense_force option will help GMAP know that the introns in your cDNA sequences are in the correct GT-AG sense, and is applicable when you have a high quality set of cDNA sequences. The sense_filter option will allow GMAP to try either sense or antisense, and to filter out sequences that appear to be antisense; this is applicable if you are uncertain about the validity of your cDNA sequences.

Again once you have built either a known splicesites or known introns file, you process it as a map file by doing

cat <file> | iit_store -o <splicesitesfile>, or
cat <file> | iit_store -o <intronsfile>
                                                                                            

which creates .iit or .iit.

Regardless of how you built .iit or .iit, you put it in the maps subdirectory by doing

cp <splicesitesfile>.iit /path/to/gmapdb/<genome>/<genome>.maps, or
cp <intronsfile>.iit /path/to/gmapdb/<genome>/<genome>.maps
                                                                                            

Then, you may use the file by doing this:

gsnap -d <genome> -s <splicesitesfile> <shortreads>, or
gsnap -d <genome> -s <intronsfile> <shortreads>, or
                                                                                            
  1. SNP-tolerant alignment in GSNAP

GSNAP has the ability to align to a reference space of all possible major and minor alleles in a set of known SNPs provided by the user. This ability is provided by the -v flag, and produces output like this:

ATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGA 2 Header ATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGt 1..36 -12:34263937..34263902 start:0..end:0,sub:1+0=1
ATGGTAATCCTGCTCAGTAGGAGAGGAACCCCAGGt 1..36 -21:14379300..14379265 start:0..end:0,sub:1+2=3

The notation “sub:1+0=1” indicates that the SNP-tolerant alignment has one mismatch (“sub:1”) and zero minor SNP alleles (“+0”), for a total of one differences (“=1”) relative to the reference genome with all major alleles. Likewise, the notation “sub:1+2=3” indicates one SNP-tolerant mismatch, two minor SNP alleles, and 3 mismatches relative to the reference sequence with all major alleles.

Note that by default, GSNAP shows only differences relative to both the reference and alternate genomes in lower case. If you want to show differences relative to the reference genome in lower case, you will need to provide the flag –show-refdiff, which would give the output above as:

ATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGA 2 Header ATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGt 1..36 -12:34263937..34263902 start:0..end:0,sub:1+0=1
ATGGTAATCCTGCTCAGTAgGAGAGGAACCcCAGGt 1..36 -21:14379300..14379265 start:0..end:0,sub:1+2=3

For SAM output format, all differences from the reference sequence are shown in the NM and MD fields, although the alignment scoring and mapping qualities are based on a SNP-tolerant alignment.

Before deciding to use SNP-tolerant alignment, please note the following. First, SNP-tolerant alignment requires more memory than standard alignment, perhaps twice as much. Also, with longer reads now of 75 or more bp, GSNAP alignments are generally fine without SNP-tolerant alignment. Finally, if your SNPs are incorrect (and many in the databases are), then they can lead SNP-tolerant alignment to favor the faulty SNPs.

If you still wish to use SNP-tolerant alignment, you will need to specify a set of known SNPs by creating a file with the following format:

rs62211261 21:14379270 CG rs62211262 21:14379281 CG

Each line must start with a “>” character, then be followed by an identifier (which may have duplicates). Then there should be the chromosomal coordinate of the SNP. (Coordinates are all 1-based, so the first character of a chromosome is number 1.) Finally, there should be the two possible alleles. (Previous versions required that these be in alphabetical order: “AC”, “AG”, “AT”, “CG”, “CT”, or “GT”, but that is no longer a requirement.) These alleles must correspond to the possible nucleotides on the plus strand of the genome. If the one of these two letters does not match the allele in the reference sequence, that SNP will be ignored in subsequent processing as a probable error.

GSNAP also supports the idea of a wildcard SNP. A wildcard SNP allows all nucleotides to match at that position, not just a given reference and alternate allele. It is essentially as if an “N” were recorded at that genomic location, although the index files still keep track of the reference allele. To indicate that a position has a wildcard SNP, you can indicate the genotype as “WN”, where “W” is the reference allele. Another indication of a wildcard SNP is to provide two separate lines at that position with the genotypes “WX” and “WY”, where “W” is the reference allele and “X” and “Y” are two different alternate alleles.

To help you generate the file, this package includes programs that can process known SNP data, from various formats, including dbSNP files, VCF format, or GVF format. The dbSNP files can be obtained from UCSC, like this

ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130.txt.gz

For versions before snp132, you may also want to exclude exceptions, which will require this file:

ftp://hgdownload.cse.ucsc.edu/goldenPath/hg18/database/snp130Exceptions.txt.gz

You can then process these files using our program dbsnp_iit, like this:

gunzip -c snp130.txt.gz | dbsnp_iit [-w <weight>] [-e snp130Exceptions.txt.gz] > <snpfile>.txt, or
gunzip -c snp130.txt.gz | dbsnp_iit [-w <weight>] [-e snp130Exceptions.txt] > <snpfile>.txt

For versions starting with snp132, the exceptions are included in column 19 of the snp file, so the -e flag is not necessary. The dbsnp_iit program will read the exceptions from that column.

The option “-w “ makes use of the dbSNP item weight, a value from 1 to 3, where lower weight means higher confidence. Items will be included if the item weight is the given value or less. The default value of -w is 1, which is the criterion UCSC uses to build its ambiguous version of the genome. To allow all item weights, specify “-w 3”.

SNPs have various types of exceptions, as provided either by the “-e “ flag, or starting with snp132, in the snp file itself. By default, dbsnp_iit will exclude all types of exceptions. However, if you want to include some types of exceptions, you will need to modify the dbsnp_iit program (written in Perl) to indicate a “1” for the type of exception you want to include.

Sometimes SNP data are provided in VCF format, and can be retrieved like this:

ftp://ftp.ncbi.nih.gov/snp/organisms/human_9606/VCF/00-All.vcf.gz

You can process VCF files using our program vcf_iit, like this:

gunzip -c 00-All.vcf.gz | vcf_iit [-v <version>] > <snpfile>.txt

The VCF file contains multiple versions of dbSNP, so if you want a particular version, such as 135, you would use the flag “-v 135”. The vcf_iit program tries to pick a subset of SNPs that somewhat parallel the ones without exceptions in the UCSC dbSNP file. It keeps all SNPs that have been validated (marked in the VCF file as “VLD”) or have a submitter link-out (“SLO”). Otherwise, it excludes SNPs that are individual genotypes (“GNO”). If none of these conditions hold, then the SNP is allowed. These rules might not be the best ones; I made them up by trying to compare version 135 of the VCF data with version 135 of the UCSC dbSNP data.

Likewise, SNP data are sometimes provided in GVF format, and these files can be processed using our program gvf_iit, like this:

gunzip -c filename.gvf.gz | gvf_iit > <snpfile>.txt

From my limited experience with GVF format, it appears that the file contains variants from only one version of dbSNP.

Once you have built a .txt file using dbsnp_iit, vcf_iit, or gvf_iit, you create an IIT file by doing this

cat <snpfile>.txt | iit_store -o <snpfile>
                                                                                            

which creates .iit. If you wish to store this file for other people to use, you can then put it in a central place:

cp <snpfile>.iit /path/to/gmapdb/<genome>/<genome>.maps

Or you can keep it in your own directory for your own use. Then you need to create a reference space index and compressed genome by doing

snpindex -d <genome> [-V <snpdirectory>] -v <snpfile> <snpfile>.iit

If you specify the [-V ] option, then the resulting SNP index files are placed in the given directory. Otherwise, if you don’t specify this, then the SNP files are saved with the reference index files.

If your .iit file is already in a .maps subdirectory, then you can simply run

snpindex -d <genome> [-V <snpdirectory>] -v <snpfile>

and the program will find the indicated .iit file. Additional options for snpindex can be found by doing “snpindex –help”.

Finally, you can perform SNP-tolerant alignment by doing

gsnap -d <genome> [-V <snpdirectory>] -v <snpfile> --use-sarray=0 <shortreads>

You can also retrieve snp information for genomic segments by running get-genome with the -v and -f flags. For more details, run “get-genome –help”. Note that you will want to turn off the suffix array algorithm, which helps GSNAP run faster, but has an inherent bias towards the reference alleles relative to the alternate alleles.

  1. Alignment of reads from bisulfite-treated DNA in GSNAP

GSNAP has the ability to align reads from bisulfite-treated DNA, which converts unmethylated cytosines to uracils that appear as thymines in reads. GSNAP is able to identify genomic-T to read-C mismatches, and produces output like this:

CTACGTcGTAGACATATTGATTCAGAATTTGAAGTTTAGCTAGATCTTAc 1 Read C.ACG.tGTAGACATA.TGATTCAGAAT.TGAAGTTTAGCTAGA.C.TAg 1..50 sub:2 +9:1000000..1000049

As with all GSNAP output, the first line is the query, and the ones afterward represent genomic segments. The “.” symbol indicates an unmethylated C in the genome that appears as a T in the read. Mismatches are shown by lower case characters in the genomic segment. In position 6, we see an example of a genomic-T that appears as a read-C, representing a mismatch. The last position also shows a mismatch between a genomic-G and read-C.

To process reads from bisulfite-treated DNA, you will first need to create the necessary index files by doing

cmetindex -d <genome>

Then, you can align the reads by doing

gsnap -d <genome> --mode=cmet-stranded, or
gsnap -d <genome> --mode=cmet-nonstranded

on your set of short reads. The stranded flag works on data where the laboratory allows only reads that go from 5’ to 3’ on each strand of the genome, and excludes their reverse complement reads that would be produced by PCR amplification. The resulting reads should have a preponderance of C’s converted to T’s.

The non-stranded flag is for the laboratory protocol that allows both the 5’-to-3’ genomic reads on each strand, as well as their reverse complements. The reverse complemented reads will have the C-to-T conversion show up as a G-to-A change. The resulting reads should have a preponderance of T’s in half the reads, and a preponderance of A’s in half the reads.

  1. RNA-editing tolerance in GSNAP

Just as GSNAP has a program cmetindex and a mode called “cmet” for tolerance to C-to-T changes, it can be tolerant to A-to-G changes using the program atoiindex and a mode called “atoi”. This mode is designed to facilitate alignments that are tolerant to RNA editing where A’s are converted to I’s, which appear as G’s to a sequencer.

To process reads under RNA-editing tolerance, you will first need to create the necessary index files by doing

atoiindex -d <genome>

Then, you can align the reads by doing

gsnap -d <genome> --mode=atoi-stranded, or 
gsnap -d <genome> --mode=atoi-nonstranded

on your set of short reads. As with bisulfite sequencing, the stranded flag is for laboratory protocols that allow only the 5’-to-3’ RNA, or sense, reads, and the non-stranded flag is for laboratory protocols that allow both sense and antisense reads.

  1. Post-processing of SAM output

This package includes a program called sam_sort, which can help sort and mark duplicates of the SAM output efficiently. (More documentation to follow.)

关于

提供 DNA/RNA 序列到参考基因组的比对功能,适合剪接比对。

11.3 MB
邀请码