Barrnap

Annotate all the bacterial RNA in your genome

Description

Barrnap is an annotation tool for identifying RNA features in microbial genomes (bacteria, arhchea, fungi). It can find:

rRNA - ribosomal RNA
tRNA - transfer RNA
tmRNA - transfer messenger RNA
ncRNA - non-coding RNA
mRNA - messenger RNA, inc. RBS, CDS, sig_pep, terminator

You provide a FASTA file, you get a GFF3 file. Too easy.

Installation

conda create -n barrnap -c bioconda -c conda-forge barrnap
conda activate barrnap

Quick start

# Backward compatible with the old versions - just rRNA

% barrnap test/small.fna
##gff-version 3
small    infernal:1.1.5    rRNA    293312    294796    1.7e-49    +    .    Name=16S_rRNA;Alias=SSU_rRNA_bacteria;Dbxref=Rfam:RF00177;product=16S ribosomal RNA
small    infernal:1.1.5    rRNA    295463    298336    4.8e-07    +    .    Name=23S_rRNA;Alias=LSU_rRNA_bacteria;Dbxref=Rfam:RF02541;product=23S ribosomal RNA
small    infernal:1.1.5    rRNA    298432    298548    1.1e-13    +    .    Name=5S_rRNA;Alias=5S_rRNA;Dbxref=Rfam:RF00001;product=5S ribosomal RNA

# Use --all to find all the RNA

% barrnap --all --threads 8 test/small.fna
##gff-version 3
mall   infernal:1.1.5    ncRNA          128     274  5.4e-05  +  .  Name=Cobalamin;Dbxref=Rfam:RF00174;product=Cobalamin riboswitch aptamer
small   aragorn:1.2.41   tmRNA        15305   15616  .        -  .  Name=tmRNA;product=transfer-messenger RNA (non-canonical) ANKIVSFSRQTAPVAA*
small  aragorn:1.2.41    tRNA         86968   87039  .        +  .  Name=tRNA-Asn;product=transfer RNA (gtt)
small  barrnap:1.6.0     mRNA        188710  189808  .        +  .  product=messenger RNA
small  pyrodigal:3.7.0   RBS         188710  188715  119.0    +  .  product=ribosome binding site AGGAG
small  pyrodigal:3.7.0   CDS         188726  189808  85.6     +  0  productr=hypothetical protein
small  TransTermHP:2.09  terminator  189857  189880  100      +  .  product=Rho-independent terminator
small  barrnap:1.6.0     operon      295463  298548  .        +  .  Name=rRNA operon;product=rRNA operon: rRNA-rRNA
small  infernal:1.1.5    rRNA        295463  298336  4.8e-07  +  .  Name=23S_rRNA;Alias=LSU_rRNA_bacteria;Dbxref=Rfam:RF02541;product=23S ribosomal RNA
small  infernal:1.1.5    rRNA        298432  298548  1.1e-13  +  .  Name=5S_rRNA;Alias=5S_rRNA;Dbxref=Rfam:RF00001;product=5S ribosomal RNA

# You can make full GFFs with header and sequence

% barrnap --incseq --incseqreg test/fake.fna
##gff-version 3
##sequence-region contig001 1 733412
##sequence-region contig002 1 542170
##sequence-region contig003 1 31088
...
##FASTA
>contig001
CCGATTAGACCACTTTGCTGATAACAGTATTCATATCAATTGATTAGAAAGATTTCTTTT
TTGGTCACATTTTGATCACTTTTGAAGAAAACAATTTTTCTTCTAGGTTTTCCTTATGAG
AAGGAATTAGAATATTGACTAGATAGGTTCTAATGGGAATCAGCCATTGGAGGTAACGGG
...

Options

General

--help show help and exit
--version print version in form barrnap X.Y and exit
--citation print a citation and exit
--debug will write all tempfiles to ‘.’ and print debug ingo

Database management

--listdb to see what DBs are installed
--updatedb to update DBs from internet
--dbdir to use a different DB folder

Search

--kingdom is the database to use: Bacteria:bac, Archaea:arc, Fungi:fun
--all only does rRNA scan, like versions < 1.0 did.
--no-rrna disables rRNA scan
--trna enables tRNA scan
--ncrna enabled ncRNA scan
--mrna enables mRNA scan (included CDS,RBS,sig_pep,terminator)

Speed

--threads is how many CPUs to uase
--fast uses simpler HMMs instead of CMs and it less accurate

Filtering

--evalue is the cut-off for hits to keep

Output

--quiet will not print any messages to stderr
--incseq will include the full input sequences in the output GFF
--incseqreg will include ##sequence-region headers in the GFF
--outseq creates a FASTA file with the hit sequences
--adids will add unique ID= tags to each GFF3 feature

FAQ

What has changed since the 0.9 version?

Barrnap now finds all RNA, not just rRNA. Use the --legacy option for backward compatiblity
I no longer use nucleotide HMMs and local alignment. To get that behaviour use --fast.
The mito model is gone, the fun model is in.
The --reject and --lencutoff paramters are ignored now, as we use global CMs now.
SILVA is no longer used, all models are from Rfam.
The --reject and --lencutoff parameters are no longer supported

Can I use Barrnap instead of Prokka ?

Yes. It’s faster, and finds more features. It’s missing some things like EC_number and COG annotations, and doen’t produce Genbank files.

Where does the name come from?

The name Barrnap was originally derived from Bacterial/Archaeal Ribosomal RNA Predictor. However it has since been extended to support mitochondrial and eukaryotic rRNAs, and has been given the new backronym BAsic Rapid Ribosomal RNA Predictor. The project was originally spawned at CodeFest 2013 in Berlin, Germany by Torsten Seemann and Tim Booth.

Databases

Barrnap sotres its database files in the db folder, with a subfolder for each --kingdom.

% barrnap --listdb

[barrnap] Database home: /home/tseemann/git/barrnap/db
[barrnap] --kingdom 'arc' has: tRNA tmRNA ncRNA rRNA
[barrnap] --kingdom 'bac' has: tRNA tmRNA ncRNA rRNA
[barrnap] --kingdom 'fun' has: tRNA tmRNA ncRNA rRNA

Because the Rfam database does not update very often, you rarely need to update them yourself using --updatedb. When there are new models, I will update them myself and make a new release of barrnap which will likely have other bugfixes and features you will want anyway.

References

Feedback

File questions, bugs, or ideas on the Issues page

License

GPLv3

Author

Torsten Seemann